p201B Cas9
(Plasmid #59177)

• Purpose: Cas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle
• Depositing Lab: Wayne Parrott
• Publication: Jacobs et al BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2.

Backbone

• Vector backbone: pPZP
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 13793
• Modifications to backbone: Inclusion of aph gene for bacterial selection on kanamycin.
• Vector type: CRISPR
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: Cas9 human-codon optimized
• Species: Synthetic
• Insert Size (bp): 5265
• Promoter: 2x35S

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: I-SceI (not destroyed)
• 3′ cloning site: I-SceI (not destroyed)
• 5′ sequencing primer: GCTGTGGCGATCGGTATTGC
• 3′ sequencing primer: TGTAAAACGACGGCCAGT

Gene/Insert 2

• Gene/Insert name: BAR
• Alt name: basta resistance
• Species: Streptomyces
• Insert Size (bp): 1650
• Promoter: 2x35S

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: AGACGTACACGGTCGACTCG
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGGA

Resource Information

• Supplemental Documents:
  • annotation table
  • Cloning protocol
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry