-
PurposeCas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPZP
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 14349
-
Modifications to backboneInclusion of aph gene for bacterial selection on kanamycin.
-
Vector typeCRISPR
-
Selectable markersG418, kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
Alt nameCas9 human-codon optimized
-
SpeciesSynthetic
-
Insert Size (bp)5265
- Promoter 2x35S
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site I-SceI (not destroyed)
- 3′ cloning site I-SceI (not destroyed)
- 5′ sequencing primer ACATGCACCTAATTTCACTAGATGT
- 3′ sequencing primer TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namenptII
-
SpeciesE. coli
-
Insert Size (bp)2184
- Promoter StUbi-3P
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
- 3′ sequencing primer GCAGAGCTTACACTCTCATTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p201N Cas9 was a gift from Wayne Parrott (Addgene plasmid # 59175 ; http://n2t.net/addgene:59175 ; RRID:Addgene_59175) -
For your References section:
Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2. 10.1186/s12896-015-0131-2 PubMed 25879861