Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWaldo-GFPd_PepTSt
(Plasmid #58333)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58333 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWALDOd
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7100
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    for expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PepTSt
  • Species
    Streptococcus thermophilus
  • Insert Size (bp)
    1450
  • Promoter T7
  • Tag / Fusion Protein
    • GFP-His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer GAAAAGTTCTCCTCCTTTGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWaldo-GFPd_PepTSt was a gift from Simon Newstead (Addgene plasmid # 58333 ; http://n2t.net/addgene:58333 ; RRID:Addgene_58333)
  • For your References section:

    Alternating access mechanism in the POT family of oligopeptide transporters. Solcan N, Kwok J, Fowler PW, Cameron AD, Drew D, Iwata S, Newstead S. EMBO J. 2012 Aug 15;31(16):3411-21. doi: 10.1038/emboj.2012.157. Epub 2012 Jun 1. 10.1038/emboj.2012.157 PubMed 22659829