pWaldo-GFPd_PepTSt
(Plasmid #58333)

• Purpose: Expresses the POT family transporter from Streptococcus thermophilus in E. coli as a C-terminally tagged GFP his tagged protein
• Depositing Lab: Simon Newstead
• Publication: Solcan et al EMBO J. 2012 Aug 15;31(16):3411-21. doi: 10.1038/emboj.2012.157. Epub 2012 Jun 1.

Backbone

• Vector backbone: pWALDOd
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 7100
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: for expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PepTSt
• Species: Streptococcus thermophilus
• Insert Size (bp): 1450
• Promoter: T7
• Tag / Fusion Protein:
  • GFP-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: T7 forward
• 3′ sequencing primer: GAAAAGTTCTCCTCCTTTGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry