pWaldo-GFPe_PepTSo
(Plasmid
#58334)
-
PurposeExpresses the POT family transporter from Shewanella oniedensis in E. coli as a C-terminally tagged GFP his tagged protein
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepWALDOe
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsfor expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePepTso
-
SpeciesShewanella oneidensis
-
Insert Size (bp)1500
- Promoter T7
-
Tag
/ Fusion Protein
- GFP-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer GAAAAGTTCTCCTCCTTTGCT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWaldo-GFPe_PepTSo was a gift from So Iwata & Simon Newstead (Addgene plasmid # 58334 ; http://n2t.net/addgene:58334 ; RRID:Addgene_58334) -
For your References section:
Crystal structure of a prokaryotic homologue of the mammalian oligopeptide-proton symporters, PepT1 and PepT2. Newstead S, Drew D, Cameron AD, Postis VL, Xia X, Fowler PW, Ingram JC, Carpenter EP, Sansom MS, McPherson MJ, Baldwin SA, Iwata S. EMBO J. 2011 Jan 19;30(2):417-26. doi: 10.1038/emboj.2010.309. Epub 2010 Dec 3. 10.1038/emboj.2010.309 PubMed 21131908