pTorPE-Y-GECO1
(Plasmid #55765)

• Purpose: Encoded a yellow fluorescent calcium ion indicator with inverted fluorescence response for expression in bacterial cells
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Integr Biol (Camb). 2014 May 19.

Backbone

• Vector backbone: Customized Vector
• Backbone size w/o insert (bp): 4125
• Vector type: Bacterial Expression ; Lab constructed

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Y-GECO1.0
• Alt name: A yellow fluorescent calcium ion indicator with inverted fluorescent response
• Species: Synthetic
• Insert Size (bp): 1368
• GenBank ID: KJ193859
• Promoter: pBAD
• Tag / Fusion Protein:
  • 6x His tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The vector is modified from pBAD/ His B (Invitrogen).