pBR322-MCK1.35lux
(Plasmid #53368)

• Purpose: expresses luciferase under 1.35 kb muscle creatine kinase promoter/enhancer
• Depositing Lab: Josephine Nalbantoglu
• Publication: Larochelle et al Gene Ther. 1997 May;4(5):465-72.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 4361
• Total vector size (bp): 6150
• Modifications to backbone: Amp resistance gene and origin of replication from pBR322. MCK 1.35 promoter/enhancer can be excised with AatII or NdeI at 5', and HindIII or EcoRI at 3' end. Luciferase gene (Photinus pyralis). SV40 pA.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: muscle creatine kinase promoter/enhancer 1.35kb
• Alt name: MCK1.35
• Species: M. musculus (mouse)
• Insert Size (bp): 1354

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI, AatII (not destroyed)
• 3′ cloning site: HindIII, EcoRI (not destroyed)
• 5′ sequencing primer: CTGTCATGCCATCCGTAAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry