Skip to main content
Addgene

pZS*11-yfp0
(Plasmid #53241)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pzs*11
  • Backbone manufacturer
    Lutz and Bujard 1997
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4353
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MG1655 but can be expressed in any strain
  • Growth instructions
    Normally the YFP production is constitutive. If grown in a strain with tet repressor, need to add 200ng/ul of anhydrotetracyline for full induction of YFP.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    YFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Promoter PLtetO1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CACCTCGAGTCCCTATCAGTG
  • 3′ sequencing primer CCTGAAGCCGGATCTGCGATTCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZS*11-yfp0 was a gift from Philippe Cluzel (Addgene plasmid # 53241 ; http://n2t.net/addgene:53241 ; RRID:Addgene_53241)
  • For your References section:

    Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria. Subramaniam AR, Pan T, Cluzel P. Proc Natl Acad Sci U S A. 2013 Feb 5;110(6):2419-24. doi: 10.1073/pnas.1211077110. Epub 2012 Dec 31. 10.1073/pnas.1211077110 PubMed 23277573