pZS*11-yfp0
(Plasmid #53241)

• Purpose: express yellow fluorescent protein (YFP) with strong T7 RBS at a low gene dosage (3-4 copies/cell)
• Depositing Lab: Philippe Cluzel
• Publication: Subramaniam et al Proc Natl Acad Sci U S A. 2013 Feb 5;110(6):2419-24. doi: 10.1073/pnas.1211077110. Epub 2012 Dec 31.

Backbone

• Vector backbone: pzs*11
• Backbone manufacturer: Lutz and Bujard 1997
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4353
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): MG1655 but can be expressed in any strain
• Growth instructions: Normally the YFP production is constitutive. If grown in a strain with tet repressor, need to add 200ng/ul of anhydrotetracyline for full induction of YFP.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: YFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: PLtetO1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CACCTCGAGTCCCTATCAGTG
• 3′ sequencing primer: CCTGAAGCCGGATCTGCGATTCTG

Resource Information

• Supplemental Documents:
  • genbank_file
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry