pGfa2(ABDx3)-nLac
(Plasmid
#53133)
-
Purposeexpression of nuclear LacZ driven by Gfa2 promoter with 3 additional copies of the gfa28 ABD segment; has about 100 times higher activity than pGfa2-nLac in transfected cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC18
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGfa2
-
Alt nameglial fibrillary acidic protein
-
Alt nameGFAP
-
SpeciesH. sapiens (human)
-
Mutation-2163 to +47, with 3 copies of 3 copies of the gfa28 ABD segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG
-
Entrez GeneGFAP (a.k.a. ALXDRD)
- Promoter human Gfa2
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- LacZ (C terminal on insert)
- mP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
- 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126)constructed by inserting 3 copies of the gfa28 ABD segment [Besnard et al., (1991) J Biol Chem 266: 18877-18883] into the Sma I site just upstream of the basal promoter. It has about 100 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGfa2(ABDx3)-nLac was a gift from Michael Brenner (Addgene plasmid # 53133 ; http://n2t.net/addgene:53133 ; RRID:Addgene_53133) -
For your References section:
Increased glia-specific transgene expression with glial fibrillary acidic protein promoters containing multiple enhancer elements. de Leeuw B, Su M, ter Horst M, Iwata S, Rodijk M, Hoeben RC, Messing A, Smitt PS, Brenner M. J Neurosci Res. 2006 Apr;83(5):744-53. 10.1002/jnr.20776 PubMed 16496373