pGfa2(ABDx3)-nLac
(Plasmid #53133)

• Purpose: expression of nuclear LacZ driven by Gfa2 promoter with 3 additional copies of the gfa28 ABD segment; has about 100 times higher activity than pGfa2-nLac in transfected cells
• Depositing Lab: Michael Brenner
• Publication: de Leeuw et al J Neurosci Res. 2006 Apr;83(5):744-53.

Backbone

• Vector backbone: pUC18
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: -2163 to +47, with 3 copies of 3 copies of the gfa28 ABD segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human Gfa2
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • LacZ (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pGfa2(ABDx3)nLac sequence with annotations
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126)constructed by inserting 3 copies of the gfa28 ABD segment [Besnard et al., (1991) J Biol Chem 266: 18877-18883] into the Sma I site just upstream of the basal promoter. It has about 100 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.