-
Purposeexpression of lacZ driven by human GfaABC1D promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC18
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGfa2
-
Alt nameglial fibrillary acidic protein
-
Alt nameGFAP
-
SpeciesH. sapiens (human)
-
Mutationcontains ABC1D regions of Gfa2 promoter, -1757 to -1256 and -132 to +47 with ATG to TGT mutation at +15
-
Entrez GeneGFAP (a.k.a. ALXDRD)
- Promoter human Gfa2
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- LacZ (C terminal on insert)
- mP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
- 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is similar to pGfa28-nlac with the addition of bp -1488 to -1256 (the first part of the C region).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGfaABC1D-nLac was a gift from Michael Brenner (Addgene plasmid # 53131 ; http://n2t.net/addgene:53131 ; RRID:Addgene_53131) -
For your References section:
GFAP promoter elements required for region-specific and astrocyte-specific expression. Lee Y, Messing A, Su M, Brenner M. Glia. 2008 Apr;56(5):481-93. doi: 10.1002/glia.20622. 10.1002/glia.20622 PubMed 18240313