Skip to main content
Addgene

pGfa(B3)-nLac
(Plasmid #53132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53132 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC18
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    -2163 to +47, with 3 copies of the gfa2 B segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126) constructed by inserting 3 copies of the gfa2 B segment (Besnard et al. 1991) into the Sma I site just upstream of the basal promoter. It has about 75 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa(B3)-nLac was a gift from Michael Brenner (Addgene plasmid # 53132 ; http://n2t.net/addgene:53132 ; RRID:Addgene_53132)
  • For your References section:

    Increased glia-specific transgene expression with glial fibrillary acidic protein promoters containing multiple enhancer elements. de Leeuw B, Su M, ter Horst M, Iwata S, Rodijk M, Hoeben RC, Messing A, Smitt PS, Brenner M. J Neurosci Res. 2006 Apr;83(5):744-53. 10.1002/jnr.20776 PubMed 16496373