pGfa28-nLac
(Plasmid #53130)

• Purpose: Expression of LacZ driven by partial human gfa2 promoter, expression is localized to a subset of astrocytes in mice.
• Depositing Lab: Michael Brenner
• Publication: Lee et al Glia. 2006 May;53(7):677-87.

Backbone

• Vector backbone: pUC18
• Total vector size (bp): 6829
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: contains the A and B regions (bp -1757 to -1489) joined to the D region (-132 to -57) and the basal promoter (-56 to +47) with the initiating ATG mutated to TTG
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human Gfa2
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • LacZ (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pGfa2--nLac sequence with annotations
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is identical to pGfa2-nLac (Addgene plasmid #53126), except that the gfa2 sequences between -2163 to -1758 and between -1488 to -133 have been deleted.