Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBICD2-TUG
(Plasmid #52873)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52873 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBICD2
  • Backbone manufacturer
    Bogan lab, unpublished
  • Backbone size w/o insert (bp) 7233
  • Modifications to backbone
    pBICD2 is identical to pMX-IRES-CD2 except that point mutations were introduced to eliminate two potential translation start sites 5' of the cloning site.
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TUG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • Entrez Gene
    Aspscr1 (a.k.a. 1190006K01Rik, ASPC, ASPCR1, ASPL, ASPS, RCC17, TUG)
  • Promoter retrovirus LTR
  • Tag / Fusion Protein
    • IRES-CD2 (mouse) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer MX1 CCACCGCCCTCAAAGTAGACG
  • 3′ sequencing primer pMI3 CCTAGATGCCATGGCCACTGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The CD2 transmembrane and extracellular sequence are encoded in the vector, after the IRES, and used for selection in FACS (Liu et al Analytical Biochem 2000, PMID 10805516).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBICD2-TUG was a gift from Jonathan Bogan (Addgene plasmid # 52873 ; http://n2t.net/addgene:52873 ; RRID:Addgene_52873)
  • For your References section:

    Functional cloning of TUG as a regulator of GLUT4 glucose transporter trafficking. Bogan JS, Hendon N, McKee AE, Tsao TS, Lodish HF. Nature. 2003 Oct 16;425(6959):727-33. 10.1038/nature01989 PubMed 14562105