pU6-Universal
(Plasmid #52694)

• Purpose: This plasmid can be used to mutate genes in Toxoplasma gondii using the CRISPR/Cas9 system after having an appropriate protospacer cloned into it.
• Depositing Lab: Sebastian Lourido
• Publication: Lourido lab Toxoplasma CRISPR Plasmid (unpublished)

Backbone

• Vector backbone: pX330
• Backbone size w/o insert (bp): 2736
• Total vector size (bp): 8371
• Vector type: CRISPR ; Toxoplasma gondii

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): dam-/dcm- (NEB catalog # C2925I)
• Growth instructions: This plasmid grows fine in DH5a, but BsaI digestion is methylation-sensitive, so growth in a Dcm- strain is necessary prior to inserting a protospacer.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Synthetic; Originally from Streptococcus progenies, codon-optimized for Plasmodium falciparum
• Insert Size (bp): 4270
• Promoter: TgTUB1
• Tags / Fusion Proteins:
  • 3X FLAG (N terminal on insert)
  • Nuclear localization signal (N terminal on insert)
  • Nuclear localization signal (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: Unknown

Gene/Insert 2

• Gene/Insert name: Toxoplasma U6 upstream region - protospacer cloning sequence - chiRNA
• Species: Synthetic; Toxoplasma gondii, streptococcus pyogenes
• Insert Size (bp): 605
• Promoter: Toxoplasma U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PciI (destroyed during cloning)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cacctctgacttgagcgtcg

Resource Information

• Supplemental Documents:
  • pU6-Universal protocol
• A portion of this plasmid was derived from a plasmid made by: Tim Wang
• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cong L, Ran FA, Cox D, Lin S, Barretto R, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819–823. doi:10.1126/science.1231143.