Skip to main content
Addgene

pLKO.1-puro U6 sgRNA BfuAI large stuffer
(Plasmid #52628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52628 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7145
  • Total vector size (bp) 8195
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kanamycin cassette
  • Species
    Bacterial origin
  • Insert Size (bp)
    1050
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a second generation plasmid that increases the efficiency of sgRNA guide cloning over the original "pLKO.1-puro U6 sgRNA BspMI stuffer" vector.

"pLKO.1-puro U6 sgRNA BfuAI large stuffer" was created to simplify the cloning of the sgRNA guide cassette into pLKO.1-puro U6 sgRNA BspMI stuffer vector originally described in the manuscript “Kearns, NA, etal. Development 2014, 141(1):219-23”. The original vector has a small intervening sequence that presents two problems: 1) the efficiency of excision by BfuAI is moderate, and 2) the size of this spacer is similar to the guide sequence, which makes distinguishing positive clones from reclosures challenging. Consequently, we have inserted a Kanamycin cassette between these sites at a unique Bcl1 site. This element is more efficiently excised by BfuAI and makes distinguishing vectors containing the desired guide sequence easy to distinguish from the parent vector. The excision of the Kan cassette by BfuAI cuts this cassette into 3 fragments due to two internal BfuAI sites within the Kan cassette. Otherwise the cloning of the guides is carried out as described in the manuscript.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 sgRNA BfuAI large stuffer was a gift from Scot Wolfe (Addgene plasmid # 52628 ; http://n2t.net/addgene:52628 ; RRID:Addgene_52628)