pCAG-hCas9D10A
(Plasmid #52101)

• Purpose: The expression vector for humanized nickase Cas9 (Cas9D10A) under CAG promoter
• Depositing Lab: Izuho Hatada
• Publication: pCAG-hCas9D10A (unpublished)

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: clontech
• Backbone size w/o insert (bp): 5800
• Modifications to backbone: The CMV promoter was replaced with CAG promoter.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hCas9D10A
• Insert Size (bp): 4160
• Mutation: D10A
• Promoter: CAG
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn I (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: CGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: TTGCATTCATTTTATGTTTCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hCas9D10A (Addgene: 41816), CAG promoter from Dr. Jun-ichi Miyazaki
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry