pCAG-T3-hCasD10A-pA
(Plasmid #51638)

• Purpose: Expresses Cas9-nickase in mammalian cells and zygotes.
• Depositing Lab: Wataru Fujii
• Publication: Fujii et al Biochem Biophys Res Commun. 2014 Jan 31. pii: S0006-291X(14)00176-4. doi: 10.1016/j.bbrc.2014.01.141.

Backbone

• Vector backbone: pCAGGS
• Total vector size (bp): 9293
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Codon-optimized Cas9 D10A
• Alt name: hCas9 D10A
• Alt name: hCas9-nickase
• Species: Synthetic
• Insert Size (bp): 4218
• Promoter: CAG promoter
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • polyA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTCCCCTTCTCCCTCTC
• 3′ sequencing primer: ATTTTTGGCAGAGGGAAAAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815) and D10A mutation was induced by PCR.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC).

For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.

The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.

The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.