pCMV-CD4-FLAG
(Plasmid #51604)

• Purpose: expresses CD4 with C-terminal FLAG tag
• Depositing Lab: Suzanne Paradis
• Publication: Raissi et al Mol Cell Neurosci. 2013 Nov;57:23-32. doi: 10.1016/j.mcn.2013.08.004. Epub 2013 Sep 10.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5300
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CD4
• Species: H. sapiens (human)
• Insert Size (bp): 1300
• GenBank ID:
• Entrez Gene: CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (C terminal on insert)
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: gagacacggagagggtcttc
• 3′ sequencing primer: CATTCTAGTTGTGGTTTGTCC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.

The CD4 insert in this plasmid contains N64I and K385E mutations when compared to GenBank reference sequence NP_038688.2.