pNJB91
(Plasmid
#51519)
-
Purpose(Empty Backbone) Gateway entry vector with attL1 and attR5 sites. Between the att sites are two FokI coding sequences transcriptionally linked by a T2A sequence. There is a nos-T after the last FokI.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZHY013
- Backbone size (bp) 4300
-
Modifications to backboneAttL2 sequence was replaced with NosT:AttR5 sequence.
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ggatcctgcgttatctagaggga
- 3′ sequencing primer tgttactagatcgggaattg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNosT and attR5 sequences were synthesized on a G-block from IDT and cloned into pZHY013.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNJB91 was a gift from Daniel Voytas (Addgene plasmid # 51519 ; http://n2t.net/addgene:51519 ; RRID:Addgene_51519) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519
Map uploaded by the depositor.
