pGL3Basic-ME.2/ApoEpromoter
(Plasmid #51436)

• Purpose: This plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancer
• Depositing Lab: Sohail Tavazoie
• Publication: Pencheva et al Cell. 2014 Feb 27;156(5):986-1001. doi: 10.1016/j.cell.2014.01.038.

Backbone

• Vector backbone: pGL3 Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6516
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: APOE apolipoprotein E
• Alt name: ME2 malic enzyme 2
• Species: H. sapiens (human)
• Insert Size (bp): 1698
• Mutation: The ME.2 enhancer is fused upstream of the ApoE gene promoter (-980/+93 bp)
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
• Entrez Gene: ME2 (a.k.a. ODS1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry