3xFLAG-dCas9/pMXs-IG
(Plasmid #51258)

• Purpose: Expresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014.

Backbone

• Vector backbone: pMXs-IG
• Backbone manufacturer: Toshio Kitamura
• Backbone size w/o insert (bp): 6091
• Total vector size (bp): 10303
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: enhanced GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: slow growing, culture for 18hrs.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3xFLAG-dCas9
• Species: Synthetic
• Insert Size (bp): 4212
• Mutation: human codon-optimized, D10A + H840A
• Promoter: LTR
• Tags / Fusion Proteins:
  • 3xFLAG tag (N terminal on insert)
  • NLS (nuclear localization signal) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Pac I (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: ggtggaccatcctctagact
• 3′ sequencing primer: AAACGCACACCGGCCTTATT

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is prone to recombination. It is recommended that recipient scientists screen multiple colonies by diagnostic digest prior to use.

The coding sequence of 3xFLAG-dCas9 can be cleaved with Pac I and Not I.

Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.

Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/