-
PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting the repetitive sequence of human MUC4 exon 3
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSico
- Total vector size (bp) 8320
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe depositing lab suggests using Stellar (Clontech) cells for growth and maximal DNA prep yield. The plasmid is provided in NEB Stable cells to reduce the chance of recombination.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoptimized sgRNA
-
Alt namesgRNA(F+E)
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)115
-
Entrez GeneMUC4 (a.k.a. ASGP, HSA276359, MUC-4)
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gacgcgccatctctaggcc
- 3′ sequencing primer atgcatggcggtaatacggttatc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GTGGCGTGACCTGTGGATGCTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1661-sgMUC4-E3(F+E) was a gift from Bo Huang & Stanley Qi (Addgene plasmid # 51025 ; http://n2t.net/addgene:51025 ; RRID:Addgene_51025) -
For your References section:
Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. 10.1016/j.cell.2013.12.001 PubMed 24360272