pSLQ1651-sgTelomere(F+E)
(Plasmid #51024)

• Purpose: Lentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeres
• Depositing Labs: Bo Huang, Stanley Qi
• Publication: Chen et al Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.

Backbone

• Vector backbone: pSico
• Total vector size (bp): 8320
• Modifications to backbone: None
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: The depositing laboratory suggests using Stellar (Clontech) for growth and maximum yield of the vector; however, the plasmid is provided in NEB Stable to reduce the chance of recombination.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Optimized sgRNA
• Alt name: sgRNA(F+E)
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 115
• Promoter: mouse U6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstXI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: atccgacgcgccatctctag
• 3′ sequencing primer: tgcatggcggtaatacggttatc

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 15 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence GTTAGGGTTAGGGTTAGGGTTA