pET20b- hTPI Lys13Arg
(Plasmid #50726)

• Purpose: overexpression of the human TPI1 Lys13Arg allele in E.coli
• Depositing Lab: Markus Ralser
• Publication: Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi: 10.1098/rsob.130232.

Backbone

• Vector backbone: pET20b
• Backbone size w/o insert (bp): 3591
• Total vector size (bp): 4340
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Triosephosphate isomerase 1
• Alt name: TPI1
• Species: H. sapiens (human)
• Insert Size (bp): 747
• Mutation: changed Lysine 13 to Argenine
• GenBank ID: NM_000365.5
• Entrez Gene: TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHIS tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry