-
PurposeCetn1 genomic region was placed in pCAG-EGxxFP. Positive control for DSB mediated EGFP reconstitution.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG-EGxxFP
- Backbone size w/o insert (bp) 6383
- Total vector size (bp) 6984
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCetn1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)619
-
Entrez GeneCetn1 (a.k.a. caltractin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agtcacTTAATAAAGGTTGG
- 3′ sequencing primer tgcaggcgcataggggctgg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySame as pCAG-EGxxFP
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGxxFP-Cetn1 was a gift from Masahito Ikawa (Addgene plasmid # 50717 ; http://n2t.net/addgene:50717 ; RRID:Addgene_50717) -
For your References section:
Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. 10.1038/srep03355 PubMed 24284873