Skip to main content
Addgene

pCAG-EGxxFP-Cetn1
(Plasmid #50717)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-EGxxFP
  • Backbone size w/o insert (bp) 6383
  • Total vector size (bp) 6984
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cetn1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    619
  • Entrez Gene
    Cetn1 (a.k.a. caltractin)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agtcacTTAATAAAGGTTGG
  • 3′ sequencing primer tgcaggcgcataggggctgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Same as pCAG-EGxxFP
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-EGxxFP-Cetn1 was a gift from Masahito Ikawa (Addgene plasmid # 50717 ; http://n2t.net/addgene:50717 ; RRID:Addgene_50717)
  • For your References section:

    Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. 10.1038/srep03355 PubMed 24284873