pHSN501
(Plasmid #50589)

• Purpose: CRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance
• Depositing Lab: Qi-Jun Chen
• Publication: Xing et al BMC Plant Biol. 2014 Nov 29;14(1):327.

Backbone

• Vector backbone: pGreen-like binary vector
• Backbone manufacturer: Mullineaux Lab, see http://www.pgreen.ac.uk/
• Vector type: CRISPR ; Plant expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin and Spectinomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: zCas9D10A
• Alt name: Cas9
• Species: Synthetic
• Mutation: Cas9D10A nickase, was derived from the zCas9 and included in the toolkit to facilitate HR-based gene replacement or NHEJ-based insertion/deletion events (indels) through offset nicking under the precondition of the avoidance of off-target effects
• Promoter: 2×35Sp
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: hSpCas9-R1, CGCTCGTGCTTCTTATCCTC

Gene/Insert 2

• Gene/Insert name: gRNA scaffold
• Species: Synthetic
• Promoter: AtU6-26p

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: RB-F1, ggataaaccttttcacgccc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry