-
PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGreen-like binary vector
-
Backbone manufacturerMullineaux Lab, see http://www.pgreen.ac.uk/
-
Vector typeCRISPR ; Plant expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name3×FLAG-NLS-zCas9-NLS
-
Alt nameCas9
-
SpeciesSynthetic
-
Mutationmaize codon optimized
- Promoter 2×35Sp
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer hSpCas9-R1, CGCTCGTGCTTCTTATCCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA scaffold
-
SpeciesSynthetic
- Promoter AtU6-26p
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer RB-F1, ggataaaccttttcacgccc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHSN401 was a gift from Qi-Jun Chen (Addgene plasmid # 50588 ; http://n2t.net/addgene:50588 ; RRID:Addgene_50588) -
For your References section:
A CRISPR/Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186/s12870-014-0327-y PubMed 25432517