AAV-CMV-LOXP-stop-LOXP-mG-CaMP3.0
(Plasmid #50022)

• Purpose: expresses Membrane tagged G-CaMP3 in cells expressing Cre
• Depositing Lab: David Anderson
• Publication: Vrontou et al Nature. 2013 Jan 31;493(7434):669-73. doi: 10.1038/nature11810.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: G-CaMP3
• Species: Synthetic
• Promoter: CMV
• Tag / Fusion Protein:
  • MARCKS sequence (MGCCFSKT) (N terminal on backbone)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: CCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: LOOGER LAb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: There are some discrepancies between the Addgene quality control sequence and the depositor's full assembled sequence. These differences are not in functionally relevant parts of the plasmid.