pC1-FGB (FlincG2)
(Plasmid #49204)

• Purpose: Fluorescent reporter for cGMP
• Depositing Lab: John Garthwaite
• Publication: Bhargava et al Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026.

Backbone

• Vector backbone: pEGFP-C1 vector
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4044
• Total vector size (bp): 5664
• Modifications to backbone: The native EGFP was deleted first and then the PCR amplified FlincG2 was cloned at Nhe I and Xho I sites.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FlincG2
• Alt name: FGB
• Alt name: CR4-C1
• Species: B. taurus (bovine); GFP
• Insert Size (bp): 1620
• Entrez Gene: PRKG1 (a.k.a. CGKI, cGK 1, cGKI-beta)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: CAACTCCGCCCCATTGACGC
• 3′ sequencing primer: None

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Wolfgang Dostmann at University of Vermont, USA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

http://www.pnas.org/content/105/1/365.long