pTriEx4-H6-FGAm (FlincG3)
(Plasmid #49202)

• Purpose: Fluorescent reporter for cGMP
• Depositing Lab: John Garthwaite
• Publication: Bhargava et al Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026.

Backbone

• Vector backbone: pTriEx4
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5238
• Total vector size (bp): 6768
• Modifications to backbone: PshA I site was used at 5' direction for inserting the insert into vector. This site was lost after ligation.
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FlincG3
• Alt name: H6-FGAm
• Alt name: MCWEx
• Species: B. taurus (bovine); GFP
• Insert Size (bp): 1764
• Mutation: Met to Lys in cpEGFP region similar to CGaMP3
• Promoter: CMV
• Tag / Fusion Protein:
  • His tag + other tags (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PshA I (destroyed during cloning)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: CCGGAGTTAATCCGGGACCT
• 3′ sequencing primer: NONE

Resource Information

• Supplemental Documents:
  • General Cloning Strategy for FlincGs in pTriEx4 vector
• A portion of this plasmid was derived from a plasmid made by: Prof. Wolfgang Dostmann at University of Vermont, USA.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

http://www.pnas.org/content/105/1/365.long