mCh-Drp1
(Plasmid #49152)

• Purpose: mammalian expression of Drp1 fused to mCherry
• Depositing Lab: Gia Voeltz
• Publication: Friedman et al Science. 2011 Oct 21;334(6054):358-62. doi: 10.1126/science.1207385. Epub 2011 Sep 1.

Backbone

• Vector backbone: mCh-alpha tubulin (Addgene plasmid )
• Backbone manufacturer: Voeltz lab
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Drp1
• Alt name: DNM1L
• Alt name: dynamin 1-like
• Alt name: Drp1, isoform 3
• Species: H. sapiens (human)
• GenBank ID: NM_005690
• Entrez Gene: DNM1L (a.k.a. DLP1, DRP1, DVLP, DYMPLE, EMPF, EMPF1, HDYNIV, OPA5)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: mCherry-F (ccccgtaatgcagaagaaga)

Resource Information

• Articles Citing this Plasmid:
  • 22 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry