Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV_dCas9_VP64
(Plasmid #49015)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49015 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    phi-Yellow-Dest
  • Backbone manufacturer
    Evrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9760
  • Modifications to backbone
    Inserted dCas9-3xNLS-VP64 along with pPGK1_mKATE-HSVpolyA
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9_VP64 (human-codon-optimized)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4410
  • Promoter CMV
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCCC
  • 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

L591M mutation with dCas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV_dCas9_VP64 was a gift from Timothy Lu (Addgene plasmid # 49015 ; http://n2t.net/addgene:49015 ; RRID:Addgene_49015)
  • For your References section:

    Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949