-
Purposeencodes human-optimized dCas9_VP64 synthetic transcription factor
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonephi-Yellow-Dest
-
Backbone manufacturerEvrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9760
-
Modifications to backboneInserted dCas9-3xNLS-VP64 along with pPGK1_mKATE-HSVpolyA
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9_VP64 (human-codon-optimized)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4410
- Promoter CMV
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCTTCGCTATTACGCCAGCCC
- 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
L591M mutation with dCas9
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_dCas9_VP64 was a gift from Timothy Lu (Addgene plasmid # 49015 ; http://n2t.net/addgene:49015 ; RRID:Addgene_49015) -
For your References section:
Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949