peft-3::cas-9::tbb-2 3'UTR
(Plasmid
#48960)
-
Purposethis plasmid contains the codon optimized gene encoding Cas9 for C. elegans.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST
-
Backbone manufacturerlife technologies
- Backbone size w/o insert (bp) 4959
- Total vector size (bp) 8732
-
Modifications to backbonea unc-54 3'UTR was cloned to the initial pDEST vector
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecas9
- Promoter eef-1A.1 (eft-3)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGCTCActccgtagcagcc
- 3′ sequencing primer aagaaagaagagtgatagagaagaaggg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peft-3::cas-9::tbb-2 3'UTR was a gift from Mario de Bono (Addgene plasmid # 48960 ; http://n2t.net/addgene:48960 ; RRID:Addgene_48960) -
For your References section:
Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Chen C, Fenk LA, de Bono M. Nucleic Acids Res. 2013 Sep 5. 10.1093/nar/gkt805 PubMed 24013562