pSpCas9 (PX165)
(Plasmid #48137)

• Purpose: Human codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS)
• Depositing Lab: Feng Zhang
• Publication: Ran et al Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24.

Backbone

• Vector backbone: PX165
• Total vector size (bp): 8300
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hSpCas9
• Alt name: SpCas9
• Alt name: Cas9
• Alt name: PX165
• Species: Synthetic
• Insert Size (bp): 5400
• Promoter: Cbh
• Tag / Fusion Protein:
  • 3XFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTGGAGCACCTGCCTGAAATCACT

Resource Information

• Supplemental Documents:
  • PX165 - NLS-hSpCas9-NLS annotated Genbank file
• Articles Citing this Plasmid:
  • 32 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.