-
PurposePesaR promoter, luxCDABE, and terminator in pET17b (AmpR)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-17b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 2934
- Total vector size (bp) 9177
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePesaR-luxCDABE-term
-
Insert Size (bp)6243
- Promoter PesaR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer cgaaaagtgccacctgacgtctaag
- 3′ sequencing primer aatcatcactttcgggaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PesaR-luxCDABE-transcriptional terminator fragment from pCS-PesaRlux is between XhoI and BglII sites in pET17b.
PesaR (274bp, indicated as lowercase letters in the 2nd partial sequence for PesaR between XhoI and BamHI) is located between XhoI and BamHI sites. luxCDABE is located between two NotI sites. The transcriptional terminator is located downstream of luxCDABE between the second NotI and BglII.
Sequencing primers provided were used to sequence PesaR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PesaRlux was a gift from Cynthia Collins (Addgene plasmid # 47802 ; http://n2t.net/addgene:47802 ; RRID:Addgene_47802) -
For your References section:
Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176
Map uploaded by the depositor.