pGEXndoE(E662Q)
(Plasmid #47716)

• Purpose: Expresses GST-EndoE(E662Q) from E. faecalis in E. coli
• Depositing Labs: Mattias Collin, Vincent Fischetti
• Publication: Collin et al J Biol Chem. 2004 May 21;279(21):22558-70. Epub 2004 Mar 17.

Backbone

• Vector backbone: pGEX-5X-3
• Backbone manufacturer: GE Helthcare
• Backbone size w/o insert (bp): 4974
• Total vector size (bp): 7306
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ndoE
• Alt name: ndoE
• Species: Entercoccus faecalis
• Insert Size (bp): 2350
• Mutation: Changed Glu-662 to Gln
• GenBank ID: AY376354
• Promoter: tac
• Tags / Fusion Proteins:
  • Glutathione S-transferase (N terminal on backbone)
  • GST-EndoE(E186Q) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry