pET-PesaR-Plux
(Plasmid #47659)

• Purpose: PesaR-P promoter, luxCDABE, and terminator in pET17b (AmpR)
• Depositing Lab: Cynthia Collins
• Publication: Shong et al ACS Synth Biol. 2013 Jul 23.

Backbone

• Vector backbone: pET-PesaRlux
• Backbone size w/o insert (bp): 8891
• Total vector size (bp): 9177
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PesaR-P
• Insert Size (bp): 286
• Mutation: Additional esa box downstream of the original esa box in PesaR
• Promoter: PesaR-P

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: tattacgctgatgtccggcctgc
• 3′ sequencing primer: aatcatcactttcgggaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PesaR-P was generated by commercial DNA synthesis.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PesaR-P (274 bp, indicated as lowercase letters in the partial sequence) was cloned between XhoI and BamHI in the same was as wt PesaR in pET-PesaRlux. The -35 and -10 sites are uppercase in the partial sequence. Please see Figure S1 (Shong and Collins, ACS Synthetic Biology, 2013) for sequence alignment of PesaR and PesaR-D. See pET-PesaRlux for more details and plasmid map.