Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-PesaR-Dlux
(Plasmid #47657)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-PesaRlux
  • Backbone size w/o insert (bp) 8891
  • Total vector size (bp) 9178
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PesaR-D
  • Insert Size (bp)
    287
  • Mutation
    Added an additional esa box upstream of -35 site in PesaR
  • Promoter PesaR-D

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cgaaaagtgccacctgacgtctaag
  • 3′ sequencing primer aatcatcactttcgggaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PesaR-D was generated by commercial DNA synthesis.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PesaR-D (275 bp, indicated as lowercase letters in the partial sequence) was cloned between XhoI and BamHI in the same was as wt PesaR in pET-PesaRlux. The -35 and -10 sites are uppercase in the partial sequence. Please see Figure S1 (Shong and Collins, ACS Synthetic Biology, 2013) for sequence alignment of PesaR and PesaR-D. See pET-PesaRlux for more details and plasmid map.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PesaR-Dlux was a gift from Cynthia Collins (Addgene plasmid # 47657 ; http://n2t.net/addgene:47657 ; RRID:Addgene_47657)
  • For your References section:

    Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176