pICH86966::AtU6p::sgRNA_PDS
(Plasmid #46966)

• Purpose: Expresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoter
• Depositing Lab: Sophien Kamoun
• Publication: Nekrasov et al Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655.

Backbone

• Vector backbone: pICH86966
• Backbone size w/o insert (bp): 6340
• Total vector size (bp): 6552
• Vector type: CRISPR ; Plant expression
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grows slowly, better incubate for 2 days
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: AtU6p::sgRNA_PDS
• Species: Synthetic
• Insert Size (bp): 212

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bsa I (destroyed during cloning)
• 3′ cloning site: Bsa I (destroyed during cloning)
• 5′ sequencing primer: gtggtgtaaacaaattgacgc
• 3′ sequencing primer: ggataaaccttttcacgccc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone vector pICH86966 comes from Sylvestre Marillonnet (Leibniz Institute of Plant Biochemistry, Germany)
• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Kamoun Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Kamoun/

gRNA target sequence GCCGTTAATTTGAGAGTCCA