pU6-sgCD71-2
(Plasmid #46918)

• Purpose: Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 gene
• Depositing Labs: Stanley Qi, Jonathan Weissman
• Publication: Gilbert et al Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.

Backbone

• Vector backbone: pSICO derivative
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 8308
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: sgCD71 -2
• Species: H. sapiens (human)
• Insert Size (bp): 103
• Entrez Gene: TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstX1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: cttgtgggagaagctcggcta

Gene/Insert 2

• Gene/Insert name: Puromycin resistance and mCherry
• Insert Size (bp): 1377
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: caccccattgacgtcaatggg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence GGACGCGCTAGTGTGAGTGC

For more information on Qi and Wiessman Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Qi-weissman/ and http://www.addgene.org/crispr/qi/