-
Purpose(Empty Backbone) Lentiviral vector for Tet-inducible expression. Puromycin-resistance
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMA3211
-
Backbone manufacturerHomemade
- Backbone size (bp) 6642
-
Vector typeLentiviral
- Promoter TRE-Tight
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ctatagtgaatagagttagg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3211 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46879 ; http://n2t.net/addgene:46879 ; RRID:Addgene_46879) -
For your References section:
Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478
