BDD FVIII H4
(Plasmid #46774)

• Purpose: pcDNA4.BDD FVIII.H4(R484H)
• Depositing Lab: Robert Peters
• Publication: Peters lab - FVIII constructs (unpublished)

Backbone

• Vector backbone: pcDNA4
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 9404
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: B-domain deleted FVIII H4 (R484H)
• Alt name: FVIII
• Species: H. sapiens (human)
• Insert Size (bp): 4371
• Mutation: R484H
• Entrez Gene: F8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: tacgactcactatagggagac
• 3′ sequencing primer: ATGATGACCGGTATGCATATTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Polymorphisms described in:
Inhibitors of factor VIII in black patients with hemophilia.

Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE.

N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544.

PMID:1936966