Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BDD FVIII H3
(Plasmid #46775)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46775 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 9404
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B-domain deleted FVIII H3 protein (M2238V)
  • Alt name
    FVIII
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4371
  • Mutation
    M2238V
  • Entrez Gene
    F8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ctatagggagacccaagctgg
  • 3′ sequencing primer CGGTATGCATATTCAGATCCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Polymorphisms described in:
Inhibitors of factor VIII in black patients with hemophilia.

Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE.

N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544.

PMID:1936966

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BDD FVIII H3 was a gift from Robert Peters (Addgene plasmid # 46775 ; http://n2t.net/addgene:46775 ; RRID:Addgene_46775)