Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBAD-LacI
(Plasmid #46394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46394 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBADmyc-hisB
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4092
  • Total vector size (bp) 5080
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LacI
  • Species
    Escherichia coli
  • Insert Size (bp)
    1110
  • Mutation
    silent T to C mutation at position 19
  • Promoter arabinose promoter
  • Tag / Fusion Protein
    • 6xHIS tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer pBADseqF (5' AGCGGATCCTACCTGACG)
  • 3′ sequencing primer pBADseqR (5' CTGAAAATCTTCTCTCATCCG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

LacI expression was induced with 0.2% (w/v) L-arabinose and cells incubated for 4 h at 20 °C.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-LacI was a gift from Florian Hollfelder (Addgene plasmid # 46394 ; http://n2t.net/addgene:46394 ; RRID:Addgene_46394)
  • For your References section:

    A single mutation in the core domain of the lac repressor reduces leakiness. Gatti-Lafranconi P, Dijkman WP, Devenish SR, Hollfelder F. Microb Cell Fact. 2013 Jul 8;12:67. doi: 10.1186/1475-2859-12-67. 10.1186/1475-2859-12-67 PubMed 23834731