pBAD-LacI
(Plasmid #46394)

• Purpose: Overproduction of LacI
• Depositing Lab: Florian Hollfelder
• Publication: Gatti-Lafranconi et al Microb Cell Fact. 2013 Jul 8;12:67. doi: 10.1186/1475-2859-12-67.

Backbone

• Vector backbone: pBADmyc-hisB
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4092
• Total vector size (bp): 5080
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LacI
• Species: Escherichia coli
• Insert Size (bp): 1110
• Mutation: silent T to C mutation at position 19
• Promoter: arabinose promoter
• Tag / Fusion Protein:
  • 6xHIS tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: pBADseqF (5' AGCGGATCCTACCTGACG)
• 3′ sequencing primer: pBADseqR (5' CTGAAAATCTTCTCTCATCCG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

LacI expression was induced with 0.2% (w/v) L-arabinose and cells incubated for 4 h at 20 °C.