pTK52_GFP-NuMA-C-3A
(Plasmid #46350)

• Depositing Lab: Iain Cheeseman
• Publication: Kiyomitsu et al Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010.

Backbone

• Vector backbone: pBABE
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7266
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NuMA C-terminal fragment
• Species: H. sapiens (human)
• Insert Size (bp): 1300
• Mutation: C-terminal fragment from 1700-2115, and changed T2015, T2055, and S2087 to A
• Entrez Gene: NUMA1 (a.k.a. NMP-22, NUMA)
• Promoter: pBABE
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry