pTK64_GFP-NuMA-Bonsai
(Plasmid
#46351)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBABE
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8955
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNuMA deleted 414-1549
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3000
-
Mutationdeleted amino acid 414-1549; L1589F mutation in NuMA
-
GenBank IDNP_006176.2
-
Entrez GeneNUMA1 (a.k.a. NMP-22, NUMA)
- Promoter pBABE
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK64_GFP-NuMA-Bonsai was a gift from Iain Cheeseman (Addgene plasmid # 46351 ; http://n2t.net/addgene:46351 ; RRID:Addgene_46351) -
For your References section:
Cortical dynein and asymmetric membrane elongation coordinately position the spindle in anaphase. Kiyomitsu T, Cheeseman IM. Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010. 10.1016/j.cell.2013.06.010 PubMed 23870127