-
Purposeunc-119 targeting sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 2641
- Total vector size (bp) 3481
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameunc-119 targeting sgRNA
-
Alt nameunc-119
-
SpeciesSynthetic
-
Insert Size (bp)840
-
Entrez Geneunc-119 (a.k.a. CELE_M142.1)
- Promoter C. elegans U6 snRNA pol III promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer M13 (-40) forward
- 3′ sequencing primer M13 (-48) reverse (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Calarco Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/calarco/
gRNA target sequence GAATTTTCTGAAATTAAAGA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PU6::unc-119_sgRNA was a gift from John Calarco (Addgene plasmid # 46169 ; http://n2t.net/addgene:46169 ; RRID:Addgene_46169) -
For your References section:
Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. 10.1038/nmeth.2532 PubMed 23817069