pGR-ECK120010783
(Plasmid
#46009)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGR
- Backbone size w/o insert (bp) 5047
- Total vector size (bp) 5096
-
Modifications to backboneInserted ECK120010783 terminator between the EcoRI and SpeI sites.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameECK120010783 Terminator
-
SpeciesE. coli
-
Insert Size (bp)49
- Promoter PBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gtccacacaatctgcccttt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGR-ECK120010783 was a gift from Christopher Voigt (Addgene plasmid # 46009 ; http://n2t.net/addgene:46009 ; RRID:Addgene_46009) -
For your References section:
Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Chen YJ, Liu P, Nielsen AA, Brophy JA, Clancy K, Peterson T, Voigt CA. Nat Methods. 2013 Jun 2. doi: 10.1038/nmeth.2515. 10.1038/nmeth.2515 PubMed 23727987