-
Purpose(Empty Backbone) Reporter plasmid for measuring terminator strength by inserting terminator of interest between the GFP and RFP, expression driven by a single PBAD promoter inducible by arabinose
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB1A10
-
Backbone manufacturerhttp://partsregistry.org/partsdb/get_part.cgi?part=pSB1A10
- Backbone size (bp) 5191
-
Modifications to backboneRemoved RNase E sites and the hairpin in front of mRFP1
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter PBAD
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtccacacaatctgcccttt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Registry of Standard Biological Parts: http://partsregistry.org/partsdb/get_part.cgi?part=pSB1A10
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a reporter plasmid for measuring terminator strength by inserting terminator of interest between the GFP and RFP, expression driven by a single PBAD promoter inducible by arabinose.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGR was a gift from Christopher Voigt (Addgene plasmid # 46002 ; http://n2t.net/addgene:46002 ; RRID:Addgene_46002) -
For your References section:
Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Chen YJ, Liu P, Nielsen AA, Brophy JA, Clancy K, Peterson T, Voigt CA. Nat Methods. 2013 Jun 2. doi: 10.1038/nmeth.2515. 10.1038/nmeth.2515 PubMed 23727987