pCRII-Topo Cav1 in situ probe
(Plasmid #45624)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4600
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cav1 in situ probe
• Alt name: Cav1
• Alt name: caveolin 1
• Alt name: caveolae protein
• Species: M. musculus (mouse)
• Insert Size (bp): 653
• Mutation: fragment contains bp# 1472-2124 of AB029929.1
• GenBank ID: NM_007616
• Entrez Gene: Cav1 (a.k.a. Cav, Cav-1)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Cav1 fragment was amplified by RT-PCR using the following primer pair:
ACCTCTCTGGACTGGCAGAA
AGTGTCGGCAAGACTGAAGG

For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication.