pCRII-Topo Plexin D1 in situ probe
(Plasmid #45621)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al Neuron. 2005 Sep 15;47(6):817-31.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4600
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Plexin D1 in situ probe
• Alt name: Plexin D1
• Alt name: Plxnd1
• Species: M. musculus (mouse)
• Mutation: fragment contains bp# 5751-6406 of NM_026376.3
• GenBank ID: NM_026376
• Entrez Gene: Plxnd1 (a.k.a. 6230425C21Rik, b2b1863Clo, b2b553Clo)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Plexin D1 fragment was amplified by RT-PCR using the following primer pair:
CAGGAAATGAACGCACACC
TGAGGGACACAGACAACTGC;
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.